Redoing trimming of reciprocal transplant seqs

I realized that I didn’t follow the Lexogen guidelines for trimming sequences from samples that were prepped for cDNA libraries using QuantSeq.

Notes (June 19, 2025)


  • Michael added me to a Box folder from UM Genomics center back in December 2024 - it is called “ReciprocalTransplant_11122024”
  • each sample has two runs (R1=left and R2=right) which indicate that it’s paired-end reads.
  • I guess in March 2025 I downloaded the sequences already onto the “2TB” external hard drive and uploaded them to Pegasus. (https://github.com/ademerlis/ademerlis.github.io/blob/main/_posts/2025-03-07-UploadingReciprocalTransplantSequencestoPegasus.md)
  • So my 3 different dissertation chapters were sequenced differently, so they need to be analyzed differently.
    • Ch 2 - Acer and Pcli stress-hardening; sequencing done at UT Austin via 3’ Tag-Seq, so I used Michael’s cutadapt trimming specific code to make sure I removed the headers correctly; single-end reads
    • Ch 3 - Acer; sequencing done at UM Genomics Center through Natalia and Lys’s plate, QuantSeq (3’ RNA-Seq?) — so I used Natalia’s TrimGalore code to ensure I trimmed it how she did it; single-end reads
    • Ch 4 - Pstr; sequencing done at UM Genomics Center; paired-end reads
  • How do I know what to do for these Pstr reads?
  • Notes on sequencing from emails from Michael and Mia:
    • submit pooled RNA-Seq libraries for sequencing on 1 NovaSeq X PE150 lane per NOAA contract 1333MJ24P0082. Based on the pooling calculations, putting in 50 fmol per 96 samples will yield ~550 uL. 50 fmol per sample would result in a final pooled molarity of 8.72 nM in 550 uL.
    • the libraries were pooled and sequenced on an Illumina platform (Illumina NovaSeq X, PE150 mode)
  • Notes from Lexogen (because cDNA libraries were prepared using QuantSeq FWD kit)
    • https://faqs.lexogen.com/faq/can-i-use-paired-end-sequencing-for-quantseq-fwd-l
      • “Paired-end (PE) sequencing is typically not recommended for QuantSeq FWD (Cat. No. 191 - 196), as the quality of Read 2 is very low due to the poly(T) stretch at the beginning of Read 2.
      • Nevertheless, QuantSeq FWD libraries can be sequenced in PE mode (i.e., 150bp) but in this case, we recommend discarding Read 2 data and proceeding with Read 1 data only for downstream data analysis (i.e., use only Read 1 for trimming, alignment, read counting, and downstream analyses).”
    • https://faqs.lexogen.com/faq/what-sequences-should-be-trimmed
      • they have specific cutadapt flags that they recommend

Notes from ChatGPT (August 4, 2025)


So my sequences were prepared using the cDNA libary kit from Lexogen (QuantSeq FWD kit), and were sequenced on an Illumina platform (NovaSeq X, PE150 mode).

ChatGPT said that there are trimming steps required for both QuantSeq and NovaSeq, which were not specifically captured in the TrimGalore script that I previously used (see below):

#! /usr/bin/env bash

#define variables for directories and files
and="/scratch/projects/and_transcriptomics"
project="and_transcriptomics"
projdir="/scratch/projects/and_transcriptomics/reciprocaltransplant"

cd "/scratch/projects/and_transcriptomics/reciprocaltransplant/raw_seq_files"

data=($(ls *.fastq.gz))

for samp in "${data[@]}" ; do \

#build script
echo "making TrimGalore script for ${samp}..."
echo "
#! /usr/bin/env bash
#BSUB -P ${project}
#BSUB -J ${samp}_trim
#BSUB -e ${projdir}/logs/${samp}_trim.err
#BSUB -o ${projdir}/logs/${samp}_trim.out
#BSUB -q general

cd \"/scratch/projects/and_transcriptomics/reciprocaltransplant/raw_seq_files\"

${and}/programs/TrimGalore-0.6.10/trim_galore ${samp} --illumina --cores 4 --three_prime_clip_R1 12 --three_prime_clip_R2 12 --nextseq 30 --length 20


" > ${projdir}/${samp}_trim.job

#submit script

bsub < ${projdir}/${samp}_trim.job

done

The flags --illumina --cores 4 --three_prime_clip_R1 12 --three_prime_clip_R2 12 --nextseq 30 --length 20are simple for trimming, but have a couple of limitations.

  • The –illumina flag tells TrimGalore to look for Illumina adapters, but isn’t specific.
  • the –three_prime_clip hard-trims 12 bases from the 3’ ends, but doesn’t do a soft-trim.
  • –nextseq 30 trims G tails due to NextSeq chemistry, which creates a poly-G artifact from 2-color sequencing, using a Q30 cutoff. This is important for Illumina NextSeq/NovaSeq
  • –length just discards reads shorter than 20 bp.

Lexogen’s trimming strategy does multiple passes, and is more specific with adapters.

Also, as per Lexogen’s suggestion, read 2 (R2) is pretty much useless for downstream analysis, so I am not going to work on trimming those anymore. I’m going to move them all into a subfolder in Pegasus and stop processing them.

  • But this begs the question then, do people use them in de novo transcriptome sequencing?? When they’re using paired-end reads, what kind of reads/sequencing were they doing to be able to do that?

I may need to complete my literature review before I keep going through this.

The lower-quality reads of R2 is in agreement with what is seen in the multiQC report even following trimming (see screenshot below and MultiQC report here), at least for the mean quality scores. The 97 green sequences are all the R1s.

Screenshot 2025-08-04 at 4 10 57 PM

New Trimming Script Using Lexogen Parameters


ChatGPT suggests using this script to specifically trim the QuantSeq + NovaSeq specific artifacts.

Lexogen QuantSeq FWD specific parameters: link to their website

  • Trims specific adapters
  • Soft-clipping of read ends
  • removing polyA (20 As) and polyG (20 Gs)
  • NextSeq trim of 10 (NovaSeq specific poly-G artifacts)
#!/usr/bin/env bash

# Define project directories and paths
and="/scratch/projects/and_transcriptomics"
project="and_transcriptomics"
projdir="${and}/reciprocaltransplant"
rawdir="${projdir}/raw_seq_files/rawreads"
logdir="${projdir}/logs/trimming_cutadapt"

cd "${rawdir}"

# Loop through R1 files
for r1 in *_R1_001.fastq.gz; do
  # Extract sample base name (e.g., "Pstr-Dec2022-202")
  base=$(echo "${r1}" | sed -E 's/_S[0-9]+_L00[1-9]_R[12]_001\.fastq\.gz//')

  r2="${r1/_R1_/_R2_}"

    echo "Creating cutadapt trim script for ${base}..."

    # Write the job script
    cat <<EOF > "${projdir}/scripts/trimming_cutadapt/${base}_cutadapt_trim.job"

#!/usr/bin/env bash
#BSUB -P ${project}
#BSUB -J ${base}_cutadapt_trim
#BSUB -e ${logdir}/${base}_cutadapt_trim.err
#BSUB -o ${logdir}/${base}_cutadapt_trim.out
#BSUB -q general
#BSUB -n 4

cd "${rawdir}"

# Step 1: Remove polyA tails and G homopolymers
cutadapt -m 20 -O 20 \\
  -a "polyA=A{20}" \\
  -a "QUALITY=G{20}" \\
  -n 2 \\
  -o ${base}_R1.step1.fastq.gz \\
  -p ${base}_R2.step1.fastq.gz \\
  ${r1} ${r2}

# Step 2: Trim NextSeq-specific poly-G tails and partial adapter sequences
cutadapt -m 20 -O 3 --nextseq-trim=10 \\
  -a "r1adapter=A{18}AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC;min_overlap=3;max_error_rate=0.1" \\
  -A "r2adapter=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT;min_overlap=3;max_error_rate=0.1" \\
  -o ${base}_R1.step2.fastq.gz \\
  -p ${base}_R2.step2.fastq.gz \\
  ${base}_R1.step1.fastq.gz ${base}_R2.step1.fastq.gz

# Step 3: Remove full-length adapter contaminations
cutadapt -m 20 -O 20 \\
  -g "r1adapter=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC;min_overlap=20" \\
  -G "r2adapter=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT;min_overlap=20" \\
  --discard-trimmed \\
  -o ${base}_R1.trimmed.fastq.gz \\
  -p ${base}_R2.trimmed.fastq.gz \\
  ${base}_R1.step2.fastq.gz ${base}_R2.step2.fastq.gz

# Clean up intermediate files (optional)
rm ${base}_R1.step1.fastq.gz ${base}_R2.step1.fastq.gz
rm ${base}_R1.step2.fastq.gz ${base}_R2.step2.fastq.gz

EOF

    # Submit the job
    bsub < "${projdir}/scripts/trimming_cutadapt/${base}_cutadapt_trim.job"
done

Submitted this, and it seems to be working!

Update: this was submitted on 1 core for cutadapt rather than 4 cores (thanks ChatGPT…) so it’s taking a really long time. I’m debating killing the jobs and re-running it since it’s 3 passes too.

I killed it and rewrote it to use 4 cores. This just requires adding “-j 4” after “cutadapt”

Update: I don’t think this did anything because in the job script it already specified 4 nodes.

from job submission time to finished trimmed read for a sample = 67 minutes

It ended up finishing the last sample at 8:48 pm. so that took ~8 hours to complete.

Written on August 4, 2025